Sing Trizol reagent according to the manufacturer’s instructions (Invitrogen, Paisley
Sing Trizol reagent according to the manufacturer’s instructions (Invitrogen, Paisley, UK). cDNA was synthesized using random hexamers and Moloney murine leukemia virus reverse transcriptase (Promega, Madison, USA). Realtime PCR was performed on a Mastercycler ep Realplex2 (Eppendorf, Germany) using SYBR Green fluorescence in accordance with manufacturer’s instructions (RealMasterMix Kit, TIANGEN, Beijing, China), using GAPDH gene as an internal control. The primer sequences were as follows: SFRS1, 5-GATTACGATGGGTACCGTCTGC3 and 5-GCAGTCCAGAGACAACCACTC-3; PRMT1, 5-GATGCTGAAGGACGAGGTGC-3 and 5-ACTCGA TCCCGATGACCTTGCG-3; GAPDH, 5-GGTCGGA GTCAACGGATTTGG-3 and 5-CATGGAATTTGCCA TGGGTGGAATC-3. The initial denaturation was performed at 95 for 1 minute, followed by 45 cycles of 10s at 95 , 10s at 55 and 15s at 68 . The PCR products were analyzed using the Realplex software. In order to monitor reproducibility and reliability, each assay was repeated three times. Stringent measures to prevent sample contamination included three non-template negative controls (NTC- reaction mix without DNA, and distilled water alone).Plasmid construction and preparationsaline (NS) in 10ml of fresh media containing 10 FBS for 24 hours or 48 hours. Cell lines were harvested at 24 and 48 hours after drug treatment, respectively, and siRNA-treated cells were harvested at 72 hours after transfection for western blot analysis. The cells were washed three times with PBS, then incubated on ice for 30 min in a 1?cell lysis buffer [20 mM Tris, 50 mM NaCl, 2 mM Na3VO4, 10mM PubMed ID:http://www.ncbi.nlm.nih.gov/pubmed/27693494 NaF, 1mM EDTA, 0.1 Triton X-100, and Proteinase Inhibitor Cocktail (Roche)], then sonicated. Following centrifugation at 4 for 30 minutes, the supernatants were frozen at -80 or used immediately.Western blot and antibodiesThe U6 promoter-driven shRNA expression vector pNeoU6+1 and the shRNA plasmid specific for firefly luciferase (sh-luc) had been prepared in advance in our lab facility. Both plasmids contained a GFP tag. The two target sites in the SRSF1 mRNA coding regions were shSRSF1-1 (62?1, GTAACTTACCTCCAGACATC) and sh-SRSF1-2 (270?89, AAGCGGCCGTGGAACAGGCC). The single shRNA targeting the PRMT1 mRNA coding region was sh-PRMT1 (379?99, GTGAAGATCGTCAAAGCCAAC). These targeted sequences were verified in the human genomic and transcriptional sequence database (NCBI) as unique sequences. The plasmids were purified using a Plasmid Mini Kit (Omega, Bio-tek) in accordance with manufacturer’s instructions.Cell culture and drug treatmentSamples containing 20 g of total protein were separated on 12 SDS-PAGE gels and then transferred onto nitrocellulose membranes (Whatman) in transfer buffer (25 mM Tris-base, 40 mM glycine, and 20 methanol) using the Mini Trans-Blot Cell (BIO-RAD) at 400 mA for 3 hours. The membranes were blocked by incubation with 5 nonfat milk in TBS-T (20 mM Tris [pH 7.6], 137mM NaCl, and 0.1 Tween 20) for 1 hour at room temperature. Proteins were detected using specific mouse monoclonal anti-SRSF1 (1:2,000, Santa Cruz, CA, USA), anti-PRMT1 (1:2,000, Sigma) or rabbit monoclonal anti-GAPDH (1:5,000, prepared in our lab) antibodies. After Necrostatin-1 chemical information washing with TBS-T, the membranes were incubated with goat anti-mouse or goat anti-rabbit immunoglobulin G secondary antibodies (1:5,000, Pierce) in TBS-T containing 5 nonfat milk for 45 min at room temperature. The proteins were visualized using an enhanced chemi-luminescence kit (Amersham). The membranes were stripped by incubation in stripping buf.