Nical samples prior to sequencing is a common practice to obtain sufficient viral genetic material for PCR amplification, as well as to avoid contaminants that may inhibit the PCR. However, it is well-recognized that the passaging of viruses in different hosts may induce excessive host-mediated mutations [33,34] that can inadvertently lead to biased conclusions. Use of the proposed modified protocol allowed successful complete genome sequencing of human influenza A/H3N2 from clinical and MDCK-cultured samples, from samples with viral loads as low as 2,400 viral RNA copies/mL RNA sample. Assay primer designs based on reference sequences collected from different geographical regions from different periods from 2007?2011, and a 96 success rate of the sequencing of 140 clinical samples collected between 2009?012 showed that this protocol would be widely applicable to a wide range of viruses. However, further testing on A/H3N2 viruses collected prior to 2009 should be performed to check the sensitivity of this full-genome sequencing assay for these earlier viruses. The two samples that encountered most failures for individual gene segment sequencing could be possibly due to sample degradation or gene reassortment events within these regions. The H3N2 subtyping results were obtained for the purposes of clinical diagnosis earlier, based on specific real-time RT-PCRs targeting HA and MP genes only. The other five samples that had single Dimethylenastron web incomplete gene sequences may possess single point mutation(s) that affected the capability of the assay to amplify those respective gene targets at either the PCR amplification or sequencing stage. The entire genomic sequencing for the influenza A/H3N2 virus can be completed with a data storage size of approximately524 (11)340 (30)388 (16)383 (21) 92.79 (5.48) 90.57 (5.73) 462?85 TTACTAAGGGCTTTCACCGAAGAG 8(NS)/B NS462FAverage percentage of bases QV30 (S.D.)94.16 (1.75)Average percentage of bases QV40 (S.D.)92.78 (4.77)92.40 (9.13)91.65 (2.20)ReferenceNucleotide position (59-39)GU89.32 (6.65)89.32 (9.21)459?38?395?CACTGTGTYARGTTTCCAGGTAGMP_459FGYCTRGTATGTGCAACATGTGANS_373RGATTGCCTGGTCCATTCTGATGCSegment/fragmentTable 1. Cont.7(MP)/B8(NS)/ANS_38FNS795RPrimersAAACAGCAGTTGYAATGCTTGCATGPrimer sequence (59-39)819?90.18 (2.32)92.50 (2.31)396 (9)Influenza 23148522 A/H3N2 Virus Genome SequencingTable 2. PCR primers and second annealing temperatures (TaS) used to amplify the influenza A/H3N2 genome.Segment/fragment 1(PB2)/APrimers MBTuni-12 PB2_841RPrimer sequence (59-39) ACGCGTGATCAGCRAAAGCAGG AGATGCTAGTGGATCTGCTGATAC AGGAATGACGATGTTGACCAAAGC CAGGACCGTTAATCTCCCACATCA GAGAGGGTGGTGGTTAGCATTG 101043-37-2 price ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG CGGAAGTCCAGACTGTTCAAG AAARGAAGGGCTATTGCAACACC CCTGYCCTTGATTGGGTTTGATC ATCAACATGAGCAAAAARAAGTCCT ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG AAGGTTCAATTTGGGCATTCACTTC CACCGAACTTCTCCTGCCTTG ATTTACCACGTCTGTGTCATTCCT CATTAACACTGCYCTGCTCAATG ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG YCCTGTTGCCAATTTCAGAGTG TCAATAATGAGATCAGATGCACCCA ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG CGCACAGGCAGGTAGGCA AGCAATGGTGGATCAAGTGAGAG ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG ATCTGACACCAGGRTATCGAGGA AGTCRGAATGCGTYTGTATCAATGG ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG AGCCATTTGCTCCATAGCCTTAG TGGGGGCTGTAACCACTGAAG ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG CTCTTCGGTGAAAGCCCTTAGT TGGACCAGGCAATCATGGAGA ACGCGTGATCAGTAGAAACAAGGNucleotide position (59-39) 1?2 864?41 778?01 1654?631 1501?522 2341?329 1?.Nical samples prior to sequencing is a common practice to obtain sufficient viral genetic material for PCR amplification, as well as to avoid contaminants that may inhibit the PCR. However, it is well-recognized that the passaging of viruses in different hosts may induce excessive host-mediated mutations [33,34] that can inadvertently lead to biased conclusions. Use of the proposed modified protocol allowed successful complete genome sequencing of human influenza A/H3N2 from clinical and MDCK-cultured samples, from samples with viral loads as low as 2,400 viral RNA copies/mL RNA sample. Assay primer designs based on reference sequences collected from different geographical regions from different periods from 2007?2011, and a 96 success rate of the sequencing of 140 clinical samples collected between 2009?012 showed that this protocol would be widely applicable to a wide range of viruses. However, further testing on A/H3N2 viruses collected prior to 2009 should be performed to check the sensitivity of this full-genome sequencing assay for these earlier viruses. The two samples that encountered most failures for individual gene segment sequencing could be possibly due to sample degradation or gene reassortment events within these regions. The H3N2 subtyping results were obtained for the purposes of clinical diagnosis earlier, based on specific real-time RT-PCRs targeting HA and MP genes only. The other five samples that had single incomplete gene sequences may possess single point mutation(s) that affected the capability of the assay to amplify those respective gene targets at either the PCR amplification or sequencing stage. The entire genomic sequencing for the influenza A/H3N2 virus can be completed with a data storage size of approximately524 (11)340 (30)388 (16)383 (21) 92.79 (5.48) 90.57 (5.73) 462?85 TTACTAAGGGCTTTCACCGAAGAG 8(NS)/B NS462FAverage percentage of bases QV30 (S.D.)94.16 (1.75)Average percentage of bases QV40 (S.D.)92.78 (4.77)92.40 (9.13)91.65 (2.20)ReferenceNucleotide position (59-39)GU89.32 (6.65)89.32 (9.21)459?38?395?CACTGTGTYARGTTTCCAGGTAGMP_459FGYCTRGTATGTGCAACATGTGANS_373RGATTGCCTGGTCCATTCTGATGCSegment/fragmentTable 1. Cont.7(MP)/B8(NS)/ANS_38FNS795RPrimersAAACAGCAGTTGYAATGCTTGCATGPrimer sequence (59-39)819?90.18 (2.32)92.50 (2.31)396 (9)Influenza 23148522 A/H3N2 Virus Genome SequencingTable 2. PCR primers and second annealing temperatures (TaS) used to amplify the influenza A/H3N2 genome.Segment/fragment 1(PB2)/APrimers MBTuni-12 PB2_841RPrimer sequence (59-39) ACGCGTGATCAGCRAAAGCAGG AGATGCTAGTGGATCTGCTGATAC AGGAATGACGATGTTGACCAAAGC CAGGACCGTTAATCTCCCACATCA GAGAGGGTGGTGGTTAGCATTG ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG CGGAAGTCCAGACTGTTCAAG AAARGAAGGGCTATTGCAACACC CCTGYCCTTGATTGGGTTTGATC ATCAACATGAGCAAAAARAAGTCCT ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG AAGGTTCAATTTGGGCATTCACTTC CACCGAACTTCTCCTGCCTTG ATTTACCACGTCTGTGTCATTCCT CATTAACACTGCYCTGCTCAATG ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG YCCTGTTGCCAATTTCAGAGTG TCAATAATGAGATCAGATGCACCCA ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG CGCACAGGCAGGTAGGCA AGCAATGGTGGATCAAGTGAGAG ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG ATCTGACACCAGGRTATCGAGGA AGTCRGAATGCGTYTGTATCAATGG ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG AGCCATTTGCTCCATAGCCTTAG TGGGGGCTGTAACCACTGAAG ACGCGTGATCAGTAGAAACAAGG ACGCGTGATCAGCRAAAGCAGG CTCTTCGGTGAAAGCCCTTAGT TGGACCAGGCAATCATGGAGA ACGCGTGATCAGTAGAAACAAGGNucleotide position (59-39) 1?2 864?41 778?01 1654?631 1501?522 2341?329 1?.